pAcUW51-CgE
(Plasmid
#13762)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13762 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAcUW51
-
Backbone manufacturerBD Biosciences
- Backbone size w/o insert (bp) 5863
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSV-1 glycoprotein E
-
Alt nameHSV-1 gE
-
SpeciesHerpes simplex virus type I KOS strain
-
Insert Size (bp)552
-
MutationC-terminal region of the HSV-1 gE (KOS strain ectodomain) was cloned downstream of the HSV-1 leader peptide by modifying Thr22 to Ala to create an AscI site to fuse the DNA encoding residues 213-390 in frame.
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGGACCTTTAATTCAACCCAAC
- 3′ sequencing primer TTGACACCAGACCAACTGGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcUW51-CgE was a gift from Pamela Bjorkman (Addgene plasmid # 13762 ; http://n2t.net/addgene:13762 ; RRID:Addgene_13762) -
For your References section:
Crystal structure of the HSV-1 Fc receptor bound to Fc reveals a mechanism for antibody bipolar bridging. Sprague ER, Wang C, Baker D, Bjorkman PJ. PLoS Biol. 2006 Jun . 4(6):e148. 10.1371/journal.pbio.0040148 PubMed 16646632
Map uploaded by the depositor.
![](https://media.addgene.org/data/easy-thumbnails/data/81/35/9222e176-af61-11e0-90fe-003048dd6500.jpeg.940x940_q85_autocrop.png)