pTol2-HuC(elavl3)-CaMPARI2
(Plasmid #137185)

• Purpose: pan-neuronal expression of CaMPARI2 in zebrafish, used to generate the CaMPARI2 zebrafish line at ZIRC (ZL13801)
• Depositing Lab: Eric Schreiter
• Publication: Moeyaert et al Nat Commun. 2018 Oct 25;9(1):4440. doi: 10.1038/s41467-018-06935-2.

Backbone

• Vector backbone: pTol2
• Backbone size w/o insert (bp): 3650
• Total vector size (bp): 13996
• Vector type: Tol2 plasmid for zebrafish

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HuC(elavl3)-CaMPARI2-FLAG-HA-myc-polyA
• Species: R. norvegicus (rat), D. rerio (zebrafish), Synthetic; Lobophyllia hemprichii
• Insert Size (bp): 10346
• Promoter: HuC(elavl3)
• Tag / Fusion Protein:
  • FLAG, HA, myc (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCAGCGAGAATGCCAAGCAT
• 3′ sequencing primer: TGCATTCTAGTTGTGGT

Resource Information

• Supplemental Documents:
  • pTol2_HuC_CaMPARI2.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry