pFastbac-Dual-StrepII-BARD1
(Plasmid
#137166)
-
PurposeExpresses human StrepII-tagged BARD1 for purification from baculovirus/insect cell system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137166 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastbac-Dual
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5237
- Total vector size (bp) 7547
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBARD1
-
Alt nameBRCA1 associated RING domain 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2334
-
Mutationfully synthetic, codon optimized for insect expression
-
Entrez GeneBARD1
- Promoter p10
-
Tag
/ Fusion Protein
- StrepII (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SphI (not destroyed)
- 5′ sequencing primer GTATATTAATTAAAATACTATACTG
- 3′ sequencing primer TTGTCTCCTTCCGTGTTTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byFully synthetic gene sequence, produced by Gene Universal
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For information about purifying BARD1 protein using this plasmid, please refer to Tan et al, 2020 PLoS One.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastbac-Dual-StrepII-BARD1 was a gift from Andrew Deans (Addgene plasmid # 137166 ; http://n2t.net/addgene:137166 ; RRID:Addgene_137166) -
For your References section:
Preparation and purification of mono-ubiquitinated proteins using Avi-tagged ubiquitin. Tan W, Murphy VJ, Charron A, van Twest S, Sharp M, Constantinou A, Parker MW, Crismani W, Bythell-Douglas R, Deans AJ. PLoS One. 2020 Feb 24;15(2):e0229000. doi: 10.1371/journal.pone.0229000. eCollection 2020. 10.1371/journal.pone.0229000 PubMed 32092106