pFastbac-Dual-StrepII-BARD1
(Plasmid #137166)

• Purpose: Expresses human StrepII-tagged BARD1 for purification from baculovirus/insect cell system
• Depositing Lab: Andrew Deans
• Publication: Tan et al PLoS One. 2020 Feb 24;15(2):e0229000. doi: 10.1371/journal.pone.0229000. eCollection 2020.

Backbone

• Vector backbone: pFastbac-Dual
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5237
• Total vector size (bp): 7547
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BARD1
• Alt name: BRCA1 associated RING domain 1
• Species: H. sapiens (human)
• Insert Size (bp): 2334
• Mutation: fully synthetic, codon optimized for insect expression
• Entrez Gene: BARD1
• Promoter: p10
• Tag / Fusion Protein:
  • StrepII (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: GTATATTAATTAAAATACTATACTG
• 3′ sequencing primer: TTGTCTCCTTCCGTGTTTCA

Resource Information

• Supplemental Documents:
  • pFastbac-Dual-BARD1.gb
• A portion of this plasmid was derived from a plasmid made by: Fully synthetic gene sequence, produced by Gene Universal

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For information about purifying BARD1 protein using this plasmid, please refer to Tan et al, 2020 PLoS One.