pHimar6
(Plasmid
#137081)
-
Purposebacterial Himar1 mini-transposon donor plasmid
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHimar6
- Backbone size w/o insert (bp) 2019
- Total vector size (bp) 3394
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Kanamycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHimar1 mini-transposon with chloramphenicol resistance gene
-
SpeciesSynthetic
-
Insert Size (bp)1375
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTGGACTCAGAAAGATGAGA
- 3′ sequencing primer GGCCGTTGCTTCGCAACGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHimar6 was a gift from Harris Wang (Addgene plasmid # 137081 ; http://n2t.net/addgene:137081 ; RRID:Addgene_137081) -
For your References section:
An Engineered Cas-Transposon System for Programmable and Site-Directed DNA Transpositions. Chen SP, Wang HH. CRISPR J. 2019 Dec;2(6):376-394. doi: 10.1089/crispr.2019.0030. Epub 2019 Nov 19. 10.1089/crispr.2019.0030 PubMed 31742433