pL0M-S-tdTomato-EC18158
(Plasmid #137078)

• Purpose: Golden Gate Level 0 S module for N-terminal fluorescent protein tagging
• Depositing Lab: Julian Hibberd
• Publication: Luginbuehl et al Plant Direct. 2020 Feb 11;4(2):e00188. doi: 10.1002/pld3.188. eCollection 2020 Feb.

Backbone

• Vector backbone: pMS-RQ GeneArt® cloning vector
• Backbone manufacturer: Thermo Fisher Scientific
• Total vector size (bp): 3959
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: tdTomato DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
• Insert Size (bp): 1465

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: M13/pUC Forward CCCAGTCACGACGTTGTAAAACG

Resource Information

• Supplemental Documents:
  • pL0M-S-tdTomato-EC18158.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

If you have any queries or discover any errors, please contact Sherif El-Sharnouby at or .

Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.