Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL0M-S-mKOκ-EC18154
(Plasmid #137077)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137077 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMS-T GeneArt® cloning vector
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Total vector size (bp) 3218
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mKOκ DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
  • Insert Size (bp)
    691

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer M13/pUC Forward CCCAGTCACGACGTTGTAAAACG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected].

Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL0M-S-mKOκ-EC18154 was a gift from Julian Hibberd (Addgene plasmid # 137077 ; http://n2t.net/addgene:137077 ; RRID:Addgene_137077)
  • For your References section:

    Fluorescent reporters for functional analysis in rice leaves. Luginbuehl LH, El-Sharnouby S, Wang N, Hibberd JM. Plant Direct. 2020 Feb 11;4(2):e00188. doi: 10.1002/pld3.188. eCollection 2020 Feb. 10.1002/pld3.188 PubMed 32072132