pL0M-S-mNeonGreen-EC18153
(Plasmid
#137075)
-
PurposeGolden Gate Level 0 S module for N-terminal fluorescent protein tagging
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMS-T GeneArt® cloning vector
-
Backbone manufacturerThermo Fisher Scientific
- Total vector size (bp) 3272
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemNeonGreen DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
-
Insert Size (bp)745
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer M13/pUC Forward CCCAGTCACGACGTTGTAAAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
If you have any queries or discover any errors, please contact Sherif El-Sharnouby at [email protected] or [email protected].
Please visit https://www.biorxiv.org/content/10.1101/649160v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL0M-S-mNeonGreen-EC18153 was a gift from Julian Hibberd (Addgene plasmid # 137075 ; http://n2t.net/addgene:137075 ; RRID:Addgene_137075) -
For your References section:
Fluorescent reporters for functional analysis in rice leaves. Luginbuehl LH, El-Sharnouby S, Wang N, Hibberd JM. Plant Direct. 2020 Feb 11;4(2):e00188. doi: 10.1002/pld3.188. eCollection 2020 Feb. 10.1002/pld3.188 PubMed 32072132