pUC57-BBclone1
(Plasmid
#137069)
-
PurposeE. coli plasmid that contains the expression optimized genes for BB0405, BB0406, P66, BBA57, HtrA, RevA and BB0238
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC57
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameBB0405
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66795.1
-
Entrez GeneBB_0405 (a.k.a. BB_0405)
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCCAGTCACGACGTTGTAAAACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBB0406
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66794.1
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CTGCTGGGCAGCCCGATGAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameP66
-
Alt nameBB0603
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66949.1
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGACCAAACCGAGCATTCTG (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameBBA57
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66270.1
Cloning Information for Gene/Insert 4
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ACCAACAACGCGGCGATTGG (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameHtrA
-
Alt nameBbHtrA BB0104
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66500.2
Cloning Information for Gene/Insert 5
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCAAAATCATTAACGCGACC (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameRevA
-
Alt nameBbm27 Bbp27 AAF07538.1
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAF07416.1
-
Entrez GenerevA (a.k.a. BB_M27)
Cloning Information for Gene/Insert 6
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAGCAAAAGCGTGAGCAACC (Common Sequencing Primers)
Gene/Insert 7
-
Gene/Insert nameBB0238
-
SpeciesBorrelia burgdorferi B31
-
Mutationwild-type, full-length (signal-peptide-containing) protein; DNA sequence was optimized for expression in E. coli
-
GenBank IDAAC66635.2
Cloning Information for Gene/Insert 7
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GTAACGGCGATAAGATGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byordered from GenScript synthesis of the expression-optimized genes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use as a PCR template for the expression optimized genes encoding BB0405, BB0406, P66, BBA57, BbHtrA, RevA, BB0238
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57-BBclone1 was a gift from Debra Hansen (Addgene plasmid # 137069 ; http://n2t.net/addgene:137069 ; RRID:Addgene_137069) -
For your References section:
Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280