pelB-MBP-P13-ss
(Plasmid #137065)

• Purpose: E. coli expression clone (T7lac promoter) for mature P13 (aa 22-179) from B. burgdorferi with N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage
• Depositing Lab: Debra Hansen
• Publication: Robertson et al Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.

Backbone

• Vector backbone: pelB-MBP (DNASU access no. EvNO00813783)
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: AAC66426.1
• Alt name: P13 BB0034
• Species: Borrelia burgdorferi B31
• Mutation: mature P13: lacks the P13 signal peptide
• Entrez Gene: BB_0034 (a.k.a. BB_0034)
• Promoter: T7lac
• Tag / Fusion Protein:
  • PelB signal peptide + His10 + maltose binding protein + TEV protease cleavage

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GAAAGGTGAAATCATGCCGAACATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pelB-MBP-P13-ss.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid uses the T7lac promoter to express in E. coli the mature (lacking the signal peptide), wild-type protein containing an N-terminal PelB signal peptide + His10 + mature maltose binding protein + TEV protease cleavage site. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli.