Skip to main content
Addgene

pHtrA-TEV-His12
(Plasmid #137036)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 137036 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRSET-TEV-12His
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAC66500.2
  • Alt name
    HtrA BbHtrA BB0104
  • Species
    Borrelia burgdorferi B31
  • Mutation
    wild type, full-length protein, contains signal peptide
  • Entrez Gene
    BB_0104 (a.k.a. BB_0104)
  • Promoter T7
  • Tag / Fusion Protein
    • His12 (TEV protease cleavable) (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid uses the T7 promoter to express in E. coli the full-length, wild-type protein containing a C-terminal TEV-protease-cleavable His12-tag. The protein sequence includes its N-terminal membrane-targeting signal peptide sequence. The gene encoding the protein does not have the same DNA sequence as B. burgdorferi because the gene has been optimized for expression in E. coli.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHtrA-TEV-His12 was a gift from Debra Hansen (Addgene plasmid # 137036 ; http://n2t.net/addgene:137036 ; RRID:Addgene_137036)
  • For your References section:

    Membrane directed expression in Escherichia coli of BBA57 and other virulence factors from the Lyme disease agent Borrelia burgdorferi. Robertson KE, Truong CD, Craciunescu FM, Chiu PL, Fromme P, Hansen DT. Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x. 10.1038/s41598-019-53830-x PubMed 31772280