pRSET-TEV-12His
(Plasmid #137032)

• Purpose: (Empty Backbone) empty vector; C-terminal TEV-protease-cleavable His12; T7 promoter; BseRI cloning sites (e.g., In-Fusion compatible)
• Depositing Lab: Debra Hansen
• Publication: Robertson et al Sci Rep. 2019 Nov 26;9(1):17606. doi: 10.1038/s41598-019-53830-x.

Backbone

• Vector backbone: pRSET-C8xHis (DNASU access no. EvNO00629010)
• Vector type: Bacterial Expression
• Promoter: T7
• Tag / Fusion Protein:
  • His12 (TEV protease cleavable) (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pRSET-TEV-12His.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This empty vector is designed to allow cloning between two BseRI restriction sites that flank a removable 432 bp insert. BseRI cleavage occurs outside of its recognition sequence, thus avoiding inclusion of any of the BseRI recognition sequence in the final expressed protein sequence. A compatible ligation-independent system is In-Fusion.