pLRC1-NEK10p:NEK10-3XFLAG
(Plasmid
#137030)
-
PurposeLentiviral vector for expressing NEK10 under the control of the endogenous NEK10 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 137030 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLRC1
- Backbone size w/o insert (bp) 8454
- Total vector size (bp) 11843
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNIMA-like kinase 10
-
Alt nameNEK10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3389
-
Entrez GeneNEK10 (a.k.a. FLJ32685)
- Promoter human NEK10 endogenous promoter
-
Tag
/ Fusion Protein
- 3XFLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggcccgaaggaatagaagaa
- 3′ sequencing primer actgccatttgtctcgaggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLRC1-NEK10p:NEK10-3XFLAG was a gift from David Sabatini (Addgene plasmid # 137030 ; http://n2t.net/addgene:137030 ; RRID:Addgene_137030) -
For your References section:
A human ciliopathy reveals essential functions for NEK10 in airway mucociliary clearance. Chivukula RR, Montoro DT, Leung HM, Yang J, Shamseldin HE, Taylor MS, Dougherty GW, Zariwala MA, Carson J, Daniels MLA, Sears PR, Black KE, Hariri LP, Almogarri I, Frenkel EM, Vinarsky V, Omran H, Knowles MR, Tearney GJ, Alkuraya FS, Sabatini DM. Nat Med. 2020 Jan 20. pii: 10.1038/s41591-019-0730-x. doi: 10.1038/s41591-019-0730-x. 10.1038/s41591-019-0730-x PubMed 31959991