pLenti-EGFP-2xFYVE
(Plasmid #136996)

• Purpose: Lentiviral EGFP lipid sensor for PI(3)P
• Depositing Lab: Ken-Ichi Takemaru
• Publication: APEX2 and lentiviral lipid sensors (unpublished)

Backbone

• Vector backbone: pEF1α-IRES-EGFP (IRES-EGFP removed)
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP-2xFYVE
• Promoter: EF1 alpha
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SfiI (not destroyed)
• 3′ cloning site: SfiI (not destroyed)
• 5′ sequencing primer: TTCTCAAGCCTCAGACAGTG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry