pAID6
(Plasmid #136989)

• Purpose: Yeast integration plasmid for expression of dLbCpf1-VP, dSpCas9-RD1152, SaCas9, and Csy4
• Depositing Lab: Huimin Zhao
• Publication: Lian et al Nat Commun. 2019 Dec 19;10(1):5794. doi: 10.1038/s41467-019-13621-4.

Backbone

• Vector backbone: pRS41K
• Backbone manufacturer: Zhao lab
• Backbone size w/o insert (bp): 4385
• Total vector size (bp): 22541
• Vector type: Yeast Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dLbCpf1-VP
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 4844
• Promoter: TDH3

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: ctgtaaatctatttcttaa

Gene/Insert 2

• Gene/Insert name: dSpCas9-RD1152
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 4803
• Promoter: TPI1

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: ttcttttcttgcttaaatct

Gene/Insert 3

• Gene/Insert name: SaCas9
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 3264
• Promoter: TEF1

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: tcttgctcattagaaagaaagcatag

Gene/Insert 4

• Gene/Insert name: Csy4
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 564
• Promoter: ENO2

Cloning Information for Gene/Insert 4

• Cloning method: Unknown
• 5′ sequencing primer: gtttctttcataacaccaagca

Resource Information

• Supplemental Documents:
  • prs41k-int-aid6.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry