AAVS1-Puro Xlone-eGFP
(Plasmid
#136936)
-
Purposedonor plasmid for inducible transgene expression in human cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVS1
- Backbone size w/o insert (bp) 10272
- Total vector size (bp) 10989
-
Vector typeMammalian Expression, Synthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameall-in-one tet-on system
-
Alt nameXlone
-
SpeciesSynthetic
-
Insert Size (bp)2474
- Promoter TRE3GS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer cgcctgtcttaggttggagt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byXlone-GFP was cloned from Addgene #96930, a gift from Dr. Xiaojun Lian Lab
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid is identical to Addgene plasmid # 179837 except this plasmid contains a WPRE sequence and plasmid 179837 does not.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-Puro Xlone-eGFP was a gift from Xiaoping Bao (Addgene plasmid # 136936 ; http://n2t.net/addgene:136936 ; RRID:Addgene_136936) -
For your References section:
Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells. Chang Y, Hellwarth PB, Randolph LN, Sun Y, Xing Y, Zhu W, Lian XL, Bao X. Biotechnol Bioeng. 2020 Apr 11. doi: 10.1002/bit.27352. 10.1002/bit.27352 PubMed 32277708