AAVS1-Puro Xlone-eGFP
(Plasmid #136936)

• Purpose: donor plasmid for inducible transgene expression in human cells
• Depositing Lab: Xiaoping Bao
• Publication: Chang et al Biotechnol Bioeng. 2020 Apr 11. doi: 10.1002/bit.27352.

Backbone

• Vector backbone: AAVS1
• Backbone size w/o insert (bp): 10272
• Total vector size (bp): 10989
• Vector type: Mammalian Expression, Synthetic Biology
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: all-in-one tet-on system
• Alt name: Xlone
• Species: Synthetic
• Insert Size (bp): 2474
• Promoter: TRE3GS

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: gcgcctataaaagagtgctga
• 3′ sequencing primer: cgcctgtcttaggttggagt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Xlone-GFP was cloned from Addgene #96930, a gift from Dr. Xiaojun Lian Lab
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid is identical to Addgene plasmid # 179837 except this plasmid contains a WPRE sequence and plasmid 179837 does not.