pLenti-hU6-mU6-Cre2GO
(Plasmid
#136907)
-
PurposeLentivirus for base editing activatable Cre recombinase expression in mammalian cells. All in one vector with sgCre2GO.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136907 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneAdapted from pLentiCRISPRv1
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBlasCyGO
-
gRNA/shRNA sequenceGACGACGGTGAGCAAGGGCG
-
SpeciesSynthetic
-
MutationATG>ACG
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hU6-mU6-Cre2GO was a gift from Lukas Dow (Addgene plasmid # 136907 ; http://n2t.net/addgene:136907 ; RRID:Addgene_136907) -
For your References section:
GO: a functional reporter system to identify and enrich base editing activity. Katti A, Foronda M, Zimmerman J, Diaz B, Zafra MP, Goswami S, Dow LE. Nucleic Acids Res. 2020 Feb 29. pii: 5766653. doi: 10.1093/nar/gkaa124. 10.1093/nar/gkaa124 PubMed 32112097
