pQLinkG2
(Plasmid #13671)

• Depositing Lab: Konrad Buessow
• Publication: Scheich et al Nucleic Acids Res. 2007 Feb 20. ():.

Backbone

• Vector backbone: pQE-2
• Backbone manufacturer: Qiagen
• Backbone size w/o insert (bp): 5508
• Vector type: Bacterial Expression ; Co-expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: multi cloning site
• Alt name: pQTEV3G2
• Insert Size (bp): 29
• Tags / Fusion Proteins:
  • GST (N terminal on backbone)
  • attB1 (N terminal on backbone)
  • TEV (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: pGEX5'
• 3′ sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the chloramphenicol resistance gene in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.