Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTet-GLI2shR
(Plasmid #136691)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136691 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Tet-pLKO-puro (Plasmid #21915)
  • Backbone size w/o insert (bp) 8758
  • Total vector size (bp) 8815
  • Modifications to backbone
    Tet-pLKO-puro (Plasmid #21915) was digested with AgeI and EcoRI to insert Gli2 shRNA-coding sequence (aattaaaaacctggcatgactaccactatgctcgagcatagtggtagtcatgccagg). The resulting pTet-GLI2shR plasmid was confirmed by single digestion with XhoI (Expected bands: 8447bp, 190bp, 136bp, 42bp)
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    shRNA_humanGli2
  • gRNA/shRNA sequence
    aattaaaaacctggcatgactaccactatgctcgagcatagtggtagtcatgccagg
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001371271
  • Entrez Gene
    GLI2 (a.k.a. CJS, HPE9, PHS2, THP1, THP2)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTet-GLI2shR was a gift from LuZhe Sun (Addgene plasmid # 136691 ; http://n2t.net/addgene:136691 ; RRID:Addgene_136691)
  • For your References section:

    Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo. Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, Wang B, Sun LZ, Zhu X. Lab Invest. 2018 Nov;98(11):1384-1396. doi: 10.1038/s41374-018-0089-5. Epub 2018 Jul 2. 10.1038/s41374-018-0089-5 PubMed 29967343