pcDNA3.3-3XFLAG-AGO2
(Plasmid #136687)

• Purpose: Expresses human AGO2 with an N-terminal 3XFLAG tag in mammalian cells (using a CMV promoter)
• Depositing Lab: David Bartel
• Publication: McGeary et al Science. 2019 Dec 20;366(6472). pii: science.aav1741. doi: 10.1126/science.aav1741. Epub 2019 Dec 5.

Backbone

• Vector backbone: pcDNA3.3
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: argonaute RISC Catalytic Component 2
• Species: H. sapiens (human)
• Insert Size (bp): 2658
• GenBank ID: 27161 NM_012154.5
• Entrez Gene: AGO2 (a.k.a. CASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10)
• Tag / Fusion Protein:
  • 3XFLAG (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATAATACCGCGCCACATAGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/414763 for bioRxiv preprint.