pQLinkHD
(Plasmid #13668)

• Depositing Lab: Konrad Buessow
• Publication: Scheich et al Nucleic Acids Res. 2007 Feb 20. ():.

Backbone

• Vector backbone: pQE-2
• Backbone manufacturer: Qiagen
• Backbone size w/o insert (bp): 4720
• Vector type: Bacterial Expression ; Co-Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Growth instructions: DB3.1 from Invitrogen
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Gateway cassette
• Alt name: pDESTco
• Insert Size (bp): 2342
• GenBank ID: EF025686
• Tag / Fusion Protein:
  • His (N terminal on backbone)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ cloning site: attR1 (destroyed during cloning)
• 3′ cloning site: attR2 (destroyed during cloning)
• 5′ sequencing primer: pQE65, TGAGCGGATAACAATTTCACACAG
• 3′ sequencing primer: pQE276, GGCAACCGAGCGTTCTGAAC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that the chloramphenicol resistance gene outside of the attB sites in this plasmid is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.