-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13667 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQE-2
-
Backbone manufacturerQiagen
- Backbone size w/o insert (bp) 4873
-
Vector typeBacterial Expression ; Co-expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemulti cloning site
-
Alt namepQTEV3
-
Insert Size (bp)28
-
GenBank IDEF025688
-
Tags
/ Fusion Proteins
- His (N terminal on backbone)
- attB1 (N terminal on backbone)
- TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pQE65, TGAGCGGATAACAATTTCACACAG
- 3′ sequencing primer pQE276, GGCAACCGAGCGTTCTGAAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the chloramphenicol resistance gene in pQLinkH is incomplete. It is lacking a promoter, therefore it is supposed to be inactive.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQLinkH was a gift from Konrad Buessow (Addgene plasmid # 13667 ; http://n2t.net/addgene:13667 ; RRID:Addgene_13667) -
For your References section:
Vectors for co-expression of an unrestricted number of proteins. Scheich C, Kummel D, Soumailakakis D, Heinemann U, Bussow K. Nucleic Acids Res. 2007 Feb 20. ():. 10.1093/nar/gkm067 PubMed 17311810