U6_sgRNA_CAG_hSt1Cas9_TH1477
(Plasmid
#136655)
-
PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneMSP1594_2x_NLS (Plasmid #110625)
- Total vector size (bp) 8715
-
Vector typeMammalian Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSt1Cas9 LMD-9:TH1477 Chimera
-
SpeciesH. sapiens (human), Synthetic
- Promoter CAG
-
Tags
/ Fusion Proteins
- SV40 NLS (N terminal on insert)
- SV40 NLS (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTACAGCTCCTGGGCAACG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namesgRNA for St1Cas9
-
SpeciesH. sapiens (human), Synthetic
- Promoter hU6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer U6 (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6_sgRNA_CAG_hSt1Cas9_TH1477 was a gift from Yannick Doyon (Addgene plasmid # 136655 ; http://n2t.net/addgene:136655 ; RRID:Addgene_136655) -
For your References section:
Versatile and robust genome editing with Streptococcus thermophilus CRISPR1-Cas9. Agudelo D, Carter S, Velimirovic M, Duringer A, Rivest JF, Levesque S, Loehr J, Mouchiroud M, Cyr D, Waters PJ, Laplante M, Moineau S, Goulet A, Doyon Y. Genome Res. 2020 Jan;30(1):107-117. doi: 10.1101/gr.255414.119. Epub 2020 Jan 3. 10.1101/gr.255414.119 PubMed 31900288