Skip to main content
Addgene

pUltra-FPheKRS
(Plasmid #136631)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136631 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUltra
  • Backbone size w/o insert (bp) 4037
  • Total vector size (bp) 5297
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    FPheKRS
  • Species
    Methanosarcina barkeri
  • Insert Size (bp)
    1260
  • Promoter Tac1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Not1 (unknown if destroyed)
  • 3′ cloning site Not1 (unknown if destroyed)
  • 5′ sequencing primer ATGGATAAAAAACCATTAGA
  • 3′ sequencing primer TTATAGATTGGTTGAAATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a 65bp insertion in the CloDF13 ori. This insertion is not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUltra-FPheKRS was a gift from Han Xiao (Addgene plasmid # 136631 ; http://n2t.net/addgene:136631 ; RRID:Addgene_136631)
  • For your References section:

    Proximity-Induced Site-Specific Antibody Conjugation. Yu C, Tang J, Loredo A, Chen Y, Jung SY, Jain A, Gordon A, Xiao H. Bioconjug Chem. 2018 Nov 21;29(11):3522-3526. doi: 10.1021/acs.bioconjchem.8b00680. Epub 2018 Nov 1. 10.1021/acs.bioconjchem.8b00680 PubMed 30372039