pHAGE2-TetOminiCMV-cMyc
(Plasmid
#136614)
-
PurposeDox-inducible lentiviral vector expressing mouse cMyc
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE2
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7576
-
Vector typeBacterial Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecMyc
-
Alt nameMyc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1320
-
GenBank ID
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
- Promoter tetO-miniCMV (dox-inducible)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer GAGACGCCATCCACGCTGT
- 3′ sequencing primer AGGAAGGTCCGCTGGATTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE2-TetOminiCMV-cMyc was a gift from Hans Schöler (Addgene plasmid # 136614 ; http://n2t.net/addgene:136614 ; RRID:Addgene_136614) -
For your References section:
Excluding Oct4 from Yamanaka Cocktail Unleashes the Developmental Potential of iPSCs. Velychko S, Adachi K, Kim KP, Hou Y, MacCarthy CM, Wu G, Scholer HR. Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. doi: 10.1016/j.stem.2019.10.002. 10.1016/j.stem.2019.10.002 PubMed 31708402