tet-pLKO.1_puro_shJUND #1
(Plasmid
#136581)
-
PurposeExpresses an inducible short hairpin targeting human JUND sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136581 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonetet-pLKO-puro
-
Backbone manufacturerAddgene # 21915
- Backbone size w/o insert (bp) 10633
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshJUNDv1
-
gRNA/shRNA sequenceGAAGAACAGAGTGTTCGATTCCTGCAGGAATCGAACACTCTGTTC
-
SpeciesH. sapiens (human)
-
GenBank IDNM_005354
-
Entrez GeneJUND (a.k.a. AP-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GGCAGGGATATTCACCATTATCGTTTCAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet-pLKO.1_puro_shJUND #1 was a gift from Kevin Janes (Addgene plasmid # 136581 ; http://n2t.net/addgene:136581 ; RRID:Addgene_136581) -
For your References section:
Sporadic activation of an oxidative stress-dependent NRF2-p53 signaling network in breast epithelial spheroids and premalignancies. Pereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA. Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200. 10.1126/scisignal.aba4200 PubMed 32291314