pHAGE2-TetOminiCMV-OKM
(Plasmid #136554)

• Purpose: Dox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Klf4, cMyc
• Depositing Lab: Hans Schöler
• Publication: Velychko et al Cell Stem Cell. 2019 Oct 30. pii: S1934-5909(19)30423-0. doi: 10.1016/j.stem.2019.10.002.

Backbone

• Vector backbone: pHAGE2
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 10285
• Vector type: Bacterial Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Oct4-T2A-Klf4-E2A-cMyc
• Alt name: Pou5f1
• Species: M. musculus (mouse)
• Insert Size (bp): 4030
• Entrez Gene: Pou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
• Entrez Gene: Myc (a.k.a. Myc2, Niard, Nird, bHLHe39)
• Entrez Gene: Klf4 (a.k.a. EZF, Gklf, Zie)
• Promoter: tetO-miniCMV (dox-inducible)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: ClaI (not destroyed)
• 5′ sequencing primer: GAGACGCCATCCACGCTGT
• 3′ sequencing primer: AGGAAGGTCCGCTGGATTGA

Resource Information

• Supplemental Documents:
  • pHAGE2-TetOminiCMV-OKM-2A-Nsi-del-from OSKM.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry