Skip to main content
Addgene

pSLIK_hygro_3xflag_NRF2(RR)
(Plasmid #136535)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136535 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSLIK-hygro
  • Backbone manufacturer
    Addgene #25737
  • Backbone size w/o insert (bp) 13286
  • Vector type
    Mammalian Expression, Lentiviral ; destinatioin vector for gateway cloning
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NRF2(1584A>C,1586A>T,1589A>G)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1815
  • Mutation
    This plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa
  • GenBank ID
    NM_006164
  • Entrez Gene
    NFE2L2 (a.k.a. HEBP1, IMDDHH, NRF2, Nrf-2)
  • Tag / Fusion Protein
    • 3x FLAG (N terminal on insert)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK_hygro_3xflag_NRF2(RR) was a gift from Kevin Janes (Addgene plasmid # 136535 ; http://n2t.net/addgene:136535 ; RRID:Addgene_136535)

  • For your References section:

    Sporadic activation of an oxidative stress-dependent NRF2-p53 signaling network in breast epithelial spheroids and premalignancies. Pereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA. Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200. 10.1126/scisignal.aba4200 PubMed 32291314
Related items:
Commonly requested with: