pEN_TTmiRc2_3xflag_CHEK2
(Plasmid
#136526)
-
PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIK
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136526 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEN_TT miRc2 3xFLAG
-
Backbone manufacturerAddgene #83274
- Backbone size w/o insert (bp) 4496
-
Vector typeentry vector for gateway cloning
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCHEK2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1632
-
GenBank IDNM_007194
-
Entrez GeneCHEK2 (a.k.a. CDS1, CHK2, HuCds1, LFS2, PP1425, RAD53, TPDS4, hCds1)
-
Tag
/ Fusion Protein
- 3x FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site MfeI (not destroyed)
- 5′ sequencing primer TGATAGAGAACGTATGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN_TTmiRc2_3xflag_CHEK2 was a gift from Kevin Janes (Addgene plasmid # 136526 ; http://n2t.net/addgene:136526 ; RRID:Addgene_136526) -
For your References section:
Sporadic activation of an oxidative stress-dependent NRF2-p53 signaling network in breast epithelial spheroids and premalignancies. Pereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA. Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200. 10.1126/scisignal.aba4200 PubMed 32291314