pEN_TTmiRC2_3xflag_NRF2(RR)
(Plasmid #136522)

• Purpose: Used as a donor vector containing N-term 3xFLAG to clone into pSLIK
• Depositing Lab: Kevin Janes
• Publication: Pereira et al Sci Signal. 2020 Apr 14;13(627). pii: 13/627/eaba4200. doi: 10.1126/scisignal.aba4200.

Backbone

• Vector backbone: pEN_TT miRc2 3xFLAG
• Backbone manufacturer: Addgene #83274
• Backbone size w/o insert (bp): 4422
• Vector type: entry vector for gateway cloning

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: NRF2(1584A>C,1586A>T,1589A>G)
• Species: H. sapiens (human)
• Insert Size (bp): 1815
• Mutation: This plasmid is developed by mutating 3 base pairs within the sequence targeted by shNRF2 version 1 (c.1584A>C,c.1586A>T,c.1589A>G) of NRF2 sequence in the pEN_TTmiRc2_3xflag_NRF2 plasmid using QuickChange II XL site-directed mutagenesis kit to create an RNAi-resistant version of NRF2. These base pair changes do not change the amino acid sequence, but switch the codons to rare codons in the human genome. Primer used: ctggaaaatatagtagaactagagcaagatttcgttcgtttgaaagatgaaaaagaaaaattgctcaaa
• GenBank ID: NM_006164
• Entrez Gene: NFE2L2 (a.k.a. HEBP1, IMDDHH, NRF2, Nrf-2)
• Tag / Fusion Protein:
  • 3x FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: MfeI (not destroyed)
• 5′ sequencing primer: actagtatggacttggagctgccg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry