Skip to main content
Addgene

pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR
(Plasmid #136514)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136514 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 7514
  • Total vector size (bp) 7994
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Codon-optimized AcrIIA5
  • Insert Size (bp)
    480
  • Promoter SFFV
  • Tag / Fusion Protein
    • FLAG/NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CACCTGTAGGTTTGGCAA
  • 3′ sequencing primer TATAGTTCTAGAGGCTCGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR was a gift from Erik Sontheimer (Addgene plasmid # 136514 ; http://n2t.net/addgene:136514 ; RRID:Addgene_136514)
  • For your References section:

    Anti-CRISPR AcrIIA5 Potently Inhibits All Cas9 Homologs Used for Genome Editing. Garcia B, Lee J, Edraki A, Hidalgo-Reyes Y, Erwood S, Mir A, Trost CN, Seroussi U, Stanley SY, Cohn RD, Claycomb JM, Sontheimer EJ, Maxwell KL, Davidson AR. Cell Rep. 2019 Nov 12;29(7):1739-1746.e5. doi: 10.1016/j.celrep.2019.10.017. 10.1016/j.celrep.2019.10.017 PubMed 31722192