pRetroX-TRE3G-PLOD2_PGK-GpNLuc
(Plasmid
#136457)
-
PurposeExpresses Tet/Dox-inducible human PLOD2 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRetroX-Tight-MCS_PGK-GpNLuc
- Backbone size w/o insert (bp) 7186
- Total vector size (bp) 10527
-
Modifications to backboneTRE3G was cloned into the RetroX backbone by excising pTight from pRetroX-Tight-MCS_PGK-GpNLuc (Addgene #70185) using XhoI and BamHI. TRE3G was PCR amplified from (https://www.addgene.org/85449/) and XhoI/BamHI sites were appended during PCR reaction. RetroX-TRE3G was digested with BamHI and EcoRI, and BamHI-PLOD2-XbaI and XbaI-T2A-Hygro-EcoRI amplicons were ligated into the new backbone.
-
Vector typeMammalian Expression, Retroviral, Luciferase
-
Selectable markerseGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRE3G::PLOD2-T2A-Hygromycin
-
Alt namePLOD2
-
Alt nameprocollagen-lysine,2-oxoglutarate 5-dioxygenase 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3737
-
GenBank ID5352
-
Entrez GenePLOD2 (a.k.a. BRKS2, LH2, TLH)
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRetroX-TRE3G-PLOD2_PGK-GpNLuc was a gift from Antonio Amelio (Addgene plasmid # 136457 ; http://n2t.net/addgene:136457 ; RRID:Addgene_136457) -
For your References section:
Lysyl hydroxylase 2-induced collagen cross-link switching promotes metastasis in head and neck squamous cell carcinomas. Sato K, Parag-Sharma K, Terajima M, Musicant AM, Murphy RM, Ramsey MR, Hibi H, Yamauchi M, Amelio AL. Neoplasia. 2021 Jun 6;23(6):594-606. doi: 10.1016/j.neo.2021.05.014. 10.1016/j.neo.2021.05.014 PubMed 34107376