Skip to main content
Addgene

pNLF1W
(Plasmid #136404)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136404 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pNLF1-N CMV-hygro
  • Backbone manufacturer
    Promega
  • Backbone size (bp) 7662
  • Modifications to backbone
    attR1 and attR2 sites for Gateway recombination, ccdB cassette and CmR for selection in bacteria
  • Vector type
    Mammalian Expression, Luciferase
  • Promoter CMV
  • Selectable markers
    Hygromycin
  • Tag / Fusion Protein
    • NanoLuc luciferase (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    after cloning the ccdB-CmR cassette is lost and only Ampicillin can be used for selection
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNLF1W was a gift from Sebastian Maurer (Addgene plasmid # 136404 ; http://n2t.net/addgene:136404 ; RRID:Addgene_136404)

  • For your References section:

    rec-YnH enables simultaneous many-by-many detection of direct protein-protein and protein-RNA interactions. Yang JS, Garriga-Canut M, Link N, Carolis C, Broadbent K, Beltran-Sastre V, Serrano L, Maurer SP. Nat Commun. 2018 Sep 14;9(1):3747. doi: 10.1038/s41467-018-06128-x. 10.1038/s41467-018-06128-x PubMed 30217970
Related items:
Commonly requested with: