Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHTNW
(Plasmid #136403)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136403 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHTN HaloTag CMV-neo
  • Backbone manufacturer
    Promega
  • Backbone size (bp) 7892
  • Modifications to backbone
    attR1 and attR2 sites for Gateway recombination, ccdB cassette and CmR for selection in bacteria
  • Vector type
    Mammalian Expression
  • Promoter CMV
  • Selectable markers
    Neomycin (select with G418)
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    after cloning the ccdB-CmR cassette is lost and only Ampicillin can be used for selection
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer CTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHTNW was a gift from Sebastian Maurer (Addgene plasmid # 136403 ; http://n2t.net/addgene:136403 ; RRID:Addgene_136403)
  • For your References section:

    rec-YnH enables simultaneous many-by-many detection of direct protein-protein and protein-RNA interactions. Yang JS, Garriga-Canut M, Link N, Carolis C, Broadbent K, Beltran-Sastre V, Serrano L, Maurer SP. Nat Commun. 2018 Sep 14;9(1):3747. doi: 10.1038/s41467-018-06128-x. 10.1038/s41467-018-06128-x PubMed 30217970