-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 13639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTACGGTGGGAGGTCTATAT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 PARL-FLAG-CT wild type was a gift from Luca Pellegrini (Addgene plasmid # 13639 ; http://n2t.net/addgene:13639 ; RRID:Addgene_13639) -
For your References section:
Self-regulated cleavage of the mitochondrial intramembrane-cleaving protease PARL yields Pbeta, a nuclear-targeted peptide. Sik A, Passer BJ, Koonin EV, Pellegrini L. J Biol Chem. 2004 Apr 9. 279(15):15323-9. 10.1074/jbc.M313756200 PubMed 14732705