Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA4.TO-ORF53-2xCSTREP
(Plasmid #136213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 136213 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA4.TO
  • Backbone manufacturer
    Invitrogen
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ORF53
  • Species
    Kaposi's sarcoma-associated herpesvirus (KSHV)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA of reactivated TREx BCBL-1-RTA cells

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA4.TO-ORF53-2xCSTREP was a gift from Britt Glaunsinger (Addgene plasmid # 136213 ; http://n2t.net/addgene:136213 ; RRID:Addgene_136213)
  • For your References section:

    Global mapping of herpesvirus-host protein complexes reveals a transcription strategy for late genes. Davis ZH, Verschueren E, Jang GM, Kleffman K, Johnson JR, Park J, Von Dollen J, Maher MC, Johnson T, Newton W, Jager S, Shales M, Horner J, Hernandez RD, Krogan NJ, Glaunsinger BA. Mol Cell. 2015 Jan 22;57(2):349-60. doi: 10.1016/j.molcel.2014.11.026. Epub 2014 Dec 24. 10.1016/j.molcel.2014.11.026 PubMed 25544563