pCDNA4.TO-ORF2-2xCSTREP
(Plasmid
#136168)
-
PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 136168 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA4.TO
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameORF2
-
SpeciesKaposi's sarcoma-associated herpesvirus (KSHV)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA of reactivated TREx BCBL-1-RTA cells
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA4.TO-ORF2-2xCSTREP was a gift from Britt Glaunsinger (Addgene plasmid # 136168 ; http://n2t.net/addgene:136168 ; RRID:Addgene_136168) -
For your References section:
Global mapping of herpesvirus-host protein complexes reveals a transcription strategy for late genes. Davis ZH, Verschueren E, Jang GM, Kleffman K, Johnson JR, Park J, Von Dollen J, Maher MC, Johnson T, Newton W, Jager S, Shales M, Horner J, Hernandez RD, Krogan NJ, Glaunsinger BA. Mol Cell. 2015 Jan 22;57(2):349-60. doi: 10.1016/j.molcel.2014.11.026. Epub 2014 Dec 24. 10.1016/j.molcel.2014.11.026 PubMed 25544563