L2_lacZgRNA-Cas9-CsA
(Plasmid
#136138)
-
PurposePlasmid to accept gRNA target with SapI, lacZ blue-white screening. Contains Cas9 and HygR.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 136138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCsA
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep5-35Sx2:HygR p5-MpU6:lacZgRNA p5-MpEF1a:Cas9-NLS
-
gRNA/shRNA sequencescaffold: tttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc
-
SpeciesMarchantia polymorpha
-
MutationBsaI/ SapI domesticated
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SapI (destroyed during cloning)
- 3′ cloning site SapI (destroyed during cloning)
- 5′ sequencing primer n/a (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.02.29.971002v1 for bioRxiv preprint.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
L2_lacZgRNA-Cas9-CsA was a gift from Jim Haseloff (Addgene plasmid # 136138 ; http://n2t.net/addgene:136138 ; RRID:Addgene_136138) -
For your References section:
Systematic tools for reprogramming plant gene expression in a simple model, Marchantia polymorpha. Sauret-Gueto S, Frangedakis E, Silvestri L, Rebmann M, Tomaselli M, Markel K, Delmans M, West A, Patron NJ, Haseloff J. ACS Synth Biol. 2020 Mar 12. doi: 10.1021/acssynbio.9b00511. 10.1021/acssynbio.9b00511 PubMed 32163700
