pcDNA3-His:CRY2:nls:VPR
(Plasmid #135989)

• Purpose: Expresses the CRY2 blue light-inducible domain fused to the VPR transcriptional activation domain in mammalian cells
• Depositing Lab: Roman Jerala
• Publication: Lebar et al Nat Chem Biol. 2020 Jan 6. pii: 10.1038/s41589-019-0443-y. doi: 10.1038/s41589-019-0443-y.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: ThermoFisher
• Backbone size w/o insert (bp): 5400
• Total vector size (bp): 8539
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CRY2 domain fused to the VPR activation domain
• Species: H. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
• Promoter: CMV
• Tag / Fusion Protein:
  • His (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Gene/Insert 2

• Gene/Insert name: CRY2 domain fused to the VPR activation domain
• Species: H. sapiens (human), M. musculus (mouse), A. thaliana (mustard weed)
• Insert Size (bp): 3126
• Tag / Fusion Protein:
  • His (N terminal on insert)

Resource Information

• Supplemental Documents:
  • pCMV-His CRY2 nls VPR.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry