1781_pAAV-U6-Ai9-Sa-gRNA1-CB-SACas9-HA-OLLAS-spA_C
(Plasmid #135979)

• Purpose: gRNA against the left loxP site of the Ai9 allele
• Depositing Lab: William Lagor
• Publication: Ai9-Sa-gRNAs (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pEMBL8
• Backbone size w/o insert (bp): 2416
• Total vector size (bp): 7164
• Vector type: Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ai9 gRNA1
• gRNA/shRNA sequence: GCTCTAGAGTCGCAGATCCTC
• Species: Staphylococcus aureus
• Promoter: U6
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: BbsI (destroyed during cloning)
• 5′ sequencing primer: CCTTCATATTTGCATATACGATACAAGGCTGTTAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry