Skip to main content
Addgene

pLL7.0-iRFP670-micro
(Plasmid #135954)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135954 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLentiLox7.0
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iLID micro (SspB R73Q)
  • Alt name
    improved light inducible dimer (iLID)
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • iRFP670 (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGCAACCAGGATTTATACAAGG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL7.0-iRFP670-micro was a gift from Antonio Amelio (Addgene plasmid # 135954 ; http://n2t.net/addgene:135954 ; RRID:Addgene_135954)

  • For your References section:

    Engineered BRET-Based Biologic Light Sources Enable Spatio-Temporal Control Over Diverse Optogenetic Systems. Parag-Sharma K, O'Banion CP, Henry EC, Musicant AM, Cleveland JL, Lawrence DS, Amelio AL. ACS Synth Biol. 2019 Dec 13. doi: 10.1021/acssynbio.9b00277. 10.1021/acssynbio.9b00277 PubMed 31834783
Related items:
Commonly requested with: