pEF1a-T2-OgNLuc
(Plasmid
#135951)
-
PurposeExpresses the OgNLuc LumiFluor targeted to the mitochondira in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135951 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEF1α-IRES-DsRed-Express2
-
Backbone manufacturerClontechLaboratories, Inc.
- Backbone size w/o insert (bp) 6022
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOgNLuc LumiFluor
-
Alt nameOgNLuc
-
SpeciesSynthetic
- Promoter EF1a
-
Tag
/ Fusion Protein
- T2 mitochondrial localization sequence (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEF1a-T2-OgNLuc was a gift from Antonio Amelio (Addgene plasmid # 135951 ; http://n2t.net/addgene:135951 ; RRID:Addgene_135951) -
For your References section:
Engineered BRET-Based Biologic Light Sources Enable Spatio-Temporal Control Over Diverse Optogenetic Systems. Parag-Sharma K, O'Banion CP, Henry EC, Musicant AM, Cleveland JL, Lawrence DS, Amelio AL. ACS Synth Biol. 2019 Dec 13. doi: 10.1021/acssynbio.9b00277. 10.1021/acssynbio.9b00277 PubMed 31834783