pWXLd-RIEP-GpNLuc
(Plasmid
#135935)
-
PurposeExpresses the GpNLuc LumiFluor in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135935 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWPXLd
- Backbone size w/o insert (bp) 10455
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGpNLuc LumiFluor
-
Alt nameGpNLuc
-
SpeciesSynthetic
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PmeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pWXLd-RIEP-GpNLuc was a gift from Antonio Amelio (Addgene plasmid # 135935 ; http://n2t.net/addgene:135935 ; RRID:Addgene_135935) -
For your References section:
Engineered BRET-Based Biologic Light Sources Enable Spatio-Temporal Control Over Diverse Optogenetic Systems. Parag-Sharma K, O'Banion CP, Henry EC, Musicant AM, Cleveland JL, Lawrence DS, Amelio AL. ACS Synth Biol. 2019 Dec 13. doi: 10.1021/acssynbio.9b00277. 10.1021/acssynbio.9b00277 PubMed 31834783