pAF164
(Plasmid
#135928)
-
PurposeAll-in-one Sleeping Beauty vector for Expression for Tasmanian devil TNFRSF9-mOrange fusion protein. Multiple cloning sites to swap genes-of-interest (i.e. TNFRSF9).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAF137 SalI + NheI digest
-
Backbone manufacturerAndrew Flies Wild Immunology Laboratory
-
Vector typeMammalian Expression ; Transposon
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNFRSF9 fused to mOrange
-
Alt nameCD137
-
Alt name41BB
-
SpeciesTasmanian devil (Sarcophilus harrisii)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mOrange (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcctcagacagtggttcaaag
- 3′ sequencing primer aggcacagtcgaggctgat (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypSBtet_Hyg_60508; pCMV(CAT)T7-SB100_34879; mOrange from mOrange-N1_54499
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See bioRxiv preprint: https://doi.org/10.1101/831404 Please see the following article for protocols on how to construct or use this vector: Flies, A. S., Darby, J. M., Murphy, P. R., Pinfold, T. L., Patchett, A. L. & Lennard, P. R. Generation and Testing of Fluorescent Adaptable Simple Theranostic (FAST) Proteins. Bio-protocol under review (2020) https://doi.org/10.21769/BioProtoc.3696.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAF164 was a gift from Andrew S. Flies (Addgene plasmid # 135928 ; http://n2t.net/addgene:135928 ; RRID:Addgene_135928) -
For your References section:
A novel system to map protein interactions reveals evolutionarily conserved immune evasion pathways on transmissible cancers. Flies AS, Darby JM, Lennard PR, Murphy PR, Ong CEB, Pinfold TL, De Luca A, Lyons AB, Woods GM, Patchett AL. Sci Adv. 2020 Jul 1;6(27). pii: 6/27/eaba5031. doi: 10.1126/sciadv.aba5031. Print 2020 Jul. 10.1126/sciadv.aba5031 PubMed 32937435