pAF163
(Plasmid #135927)

• Purpose: All-in-one Sleeping Beauty vector for Expression for Tasmanian devil TNFRSF9-mNeptune2 fusion protein. Multiple cloning sites to swap genes-of-interest (i.e. TNFRSF9).
• Depositing Lab: Andrew S. Flies
• Publication: Flies et al Sci Adv. 2020 Jul 1;6(27). pii: 6/27/eaba5031. doi: 10.1126/sciadv.aba5031. Print 2020 Jul.

Backbone

• Vector backbone: pAF137 SalI + NheI digest
• Backbone manufacturer: Andrew Flies Wild Immunology Laboratory
• Vector type: Mammalian Expression ; Transposon
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TNFRSF9 fused to mNeptune2
• Alt name: CD137
• Alt name: 41BB
• Species: Tasmanian devil (Sarcophilus harrisii)
• Promoter: EF1a
• Tag / Fusion Protein:
  • mNeptune2 (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcctcagacagtggttcaaag
• 3′ sequencing primer: aggcacagtcgaggctgat

Resource Information

• Supplemental Documents:
  • pAF163.gb
• A portion of this plasmid was derived from a plasmid made by: pSBtet_Hyg_60508; pCMV(CAT)T7-SB100_34879; mNeptune2-N1_54837
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See bioRxiv preprint: https://doi.org/10.1101/831404 Please see the following article for protocols on how to construct or use this vector: Flies, A. S., Darby, J. M., Murphy, P. R., Pinfold, T. L., Patchett, A. L. & Lennard, P. R. Generation and Testing of Fluorescent Adaptable Simple Theranostic (FAST) Proteins. Bio-protocol under review (2020) https://doi.org/10.21769/BioProtoc.3696.