pGL3-Basic-hCYP26A1-FL- luciferase
(Plasmid #135566)

• Purpose: Full Length promoter of the human CYP26A1 gene in pGL3-Basic-luciferase
• Depositing Lab: Catharine Ross
• Publication: Zolfaghari et al J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839.

Backbone

• Vector backbone: pGL3-Basic-luciferase
• Backbone size w/o insert (bp): 4818
• Total vector size (bp): 6968
• Selectable markers: None

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Follow the protocol from Promega.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Full-length promoter of human retinoic acid receptor-beta gene
• Alt name: CYP26A1P
• Species: H. sapiens (human)
• Insert Size (bp): 2150
• Promoter: hHuman CYP26A1 gene promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: AGCAAGCTTGTACAGATAGATTAAAACGT
• 3′ sequencing primer: AATAAGCTTCACGAAGGTGCAGAGCGC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

PCR amplified full-length (FL) promoter of the human CYP26A1 gene was cloned from the FOSMID vector into HindIII site of the pGL3 Basic Luciferase reporter vector (see Zhang et. al, 2010, Gene 464: 32–43). An isolated clone was digested with AscI and AleI and then re-ligated to form pGL3-Basic-hCYP26A1-FL-luciferase clone containing the FL promoter covering from −2139 5’upstream to + 11 3’downstream position of the transcription start site in the gene. An isolated pGL3-Basic-hCYP26A1-FL-luciferase clone was submitted to sequencing for confirmation.