pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
(Plasmid #135565)

• Purpose: An AAV vector expressing miR-30a shRNA vs rat SOM (aka SST) and a nuclear EYFP reporter
• Depositing Lab: Christopher Richie
• Publication: Venniro et al Proc Natl Acad Sci U S A. 2020 Apr 7;117(14):8126-8134. doi: 10.1073/pnas.2001615117. Epub 2020 Mar 23.

Backbone

• Vector backbone: pAAV SYN1 iRFP-FLAG
• Total vector size (bp): 6000
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: miR-30 rat SST
• Alt name: miRNA vs Firefly somatostatin
• Species: R. norvegicus (rat)
• Promoter: SYN1

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ATGAAAGCCATACGGGAAGC

Gene/Insert 2

• Gene/Insert name: Nuc-EYFP
• Alt name: Yellow Fluorescent protein
• Insert Size (bp): 800
• Promoter: hSYN1
• Tag / Fusion Protein:
  • 3xNLS (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: ATGAAAGCCATACGGGAAGC

Resource Information

• Supplemental Documents:
  • pOTTC1619 - pAAV SYN1 Nuc-EYFP miR-30 SST.ape.ape.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry