pcDNA3.1(+)-Rab10-FLAG
(Plasmid
#135559)
-
PurposeExpress mouse Rab10 in mammalian cells, FLAG at N terminal
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135559 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRab10
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)600
-
Entrez GeneRab10 (a.k.a. AW107754)
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer T7 promoter
- 3′ sequencing primer CTGGCAACTAGAAGGCACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1(+)-Rab10-FLAG was a gift from Jingshi Shen (Addgene plasmid # 135559 ; http://n2t.net/addgene:135559 ; RRID:Addgene_135559) -
For your References section:
RABIF/MSS4 is a Rab-stabilizing holdase chaperone required for GLUT4 exocytosis. Gulbranson DR, Davis EM, Demmitt BA, Ouyang Y, Ye Y, Yu H, Shen J. Proc Natl Acad Sci U S A. 2017 Sep 26;114(39):E8224-E8233. doi: 10.1073/pnas.1712176114. Epub 2017 Sep 11. 10.1073/pnas.1712176114 PubMed 28894007