pFastBac HT JS-Munc18b
(Plasmid
#135554)
-
PurposeExpress rat Munc18b in Sf9 cells, the resulted plasmid encodes an N-terminally His6-tagged Munc18c protein with a tobacco etch virus (TEV) cleavage site between the His6 tag and Munc18b.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMunc18b
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1782
- Promoter polyhedrin promoter
-
Tag
/ Fusion Protein
- 6xHis tag and TEV site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CAGTTTTGTAATAAAAAAACCTATAAAT
- 3′ sequencing primer TAAGCTGCAATAAACAAGTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac HT JS-Munc18b was a gift from Jingshi Shen (Addgene plasmid # 135554 ; http://n2t.net/addgene:135554 ; RRID:Addgene_135554) -
For your References section:
Functional Reconstitution of Intracellular Vesicle Fusion Using Purified SNAREs and Sec1/Munc18 (SM) Proteins. Yu H, Crisman L, Stowell MHB, Shen J. Methods Mol Biol. 2019;1860:237-249. doi: 10.1007/978-1-4939-8760-3_15. 10.1007/978-1-4939-8760-3_15 PubMed 30317509