Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGI3EM22C
(Plasmid #135488)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135488 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGI3EM20C
  • Backbone size w/o insert (bp) 12668
  • Total vector size (bp) 12739
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Used in Agrobacterium EHA105 for transformation
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hph SpunH2A/Bpr LifeAct-tdTomato
  • Species
    S. cerevisiae (budding yeast); Spizellomyces punctatus
  • Insert Size (bp)
    72
  • Promoter SpunH2A/Bpr (divergent)
  • Tag / Fusion Protein
    • LifeAct (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tttatgctccaagcggagac
  • 3′ sequencing primer cttgtacagctcgtccatgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The pGI3 vector was a gift from Giuseppe Ianiri

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGI3EM22C was a gift from Nicolas Buchler (Addgene plasmid # 135488 ; http://n2t.net/addgene:135488 ; RRID:Addgene_135488)
  • For your References section:

    Genetic transformation of Spizellomyces punctatus, a resource for studying chytrid biology and evolutionary cell biology. Medina EM, Robinson KA, Bellingham-Johnstun K, Ianiri G, Laplante C, Fritz-Laylin LK, Buchler NE. Elife. 2020 May 11;9. pii: 52741. doi: 10.7554/eLife.52741. 10.7554/eLife.52741 PubMed 32392127